Transcript: Human NM_001010854.2

Homo sapiens tetratricopeptide repeat domain 7B (TTC7B), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
TTC7B (145567)
Length:
19471
CDS:
136..2667

Additional Resources:

NCBI RefSeq record:
NM_001010854.2
NBCI Gene record:
TTC7B (145567)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001010854.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000130299 GCCTGTTACAAGAGAAGGAAA pLKO.1 3260 3UTR 100% 4.950 3.960 N TTC7B n/a
2 TRCN0000146381 CCATGTGCGTTTCTCTTGTTT pLKO.1 2834 3UTR 100% 5.625 3.938 N TTC7B n/a
3 TRCN0000148794 CGCTACCAAAGGACTTTGTTT pLKO.1 570 CDS 100% 5.625 3.938 N TTC7B n/a
4 TRCN0000146260 CCAGAAACCAAATGTGAACTT pLKO.1 3091 3UTR 100% 4.950 3.465 N TTC7B n/a
5 TRCN0000146681 CCTACAAGAATCCAATCTGAT pLKO.1 420 CDS 100% 4.950 3.465 N TTC7B n/a
6 TRCN0000130345 GCATCTGTGGTCTATGACTTA pLKO.1 1219 CDS 100% 4.950 3.465 N TTC7B n/a
7 TRCN0000129237 CCAGCTGACAATTTCTTGGTT pLKO.1 3149 3UTR 100% 3.000 2.100 N TTC7B n/a
8 TRCN0000130318 GCAGATATGGAAATCCTGCTA pLKO.1 1965 CDS 100% 2.640 1.848 N TTC7B n/a
9 TRCN0000149218 GTTTGGAGAAGCTGCCTATTT pLKO.1 587 CDS 100% 13.200 7.920 N TTC7B n/a
10 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 14006 3UTR 100% 5.625 2.813 Y EID2B n/a
11 TRCN0000155229 GATCAAGACCATCCTGGCTAA pLKO.1 16251 3UTR 100% 4.050 2.025 Y INTS7 n/a
12 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 12704 3UTR 100% 5.625 2.813 Y KLHL30 n/a
13 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 6565 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001010854.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.