Transcript: Human NM_001010859.3

Homo sapiens chromosome 22 open reading frame 42 (C22orf42), mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
C22orf42 (150297)
Length:
1378
CDS:
89..844

Additional Resources:

NCBI RefSeq record:
NM_001010859.3
NBCI Gene record:
C22orf42 (150297)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001010859.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000417510 AGACTTCATGACATCGGATCT pLKO_005 625 CDS 100% 4.050 5.670 N C22orf42 n/a
2 TRCN0000165075 GACCACCATTTGGTCGAAGAT pLKO.1 575 CDS 100% 0.495 0.693 N C22orf42 n/a
3 TRCN0000161236 GAGGAGAATATAACGTCAGAT pLKO.1 530 CDS 100% 4.950 6.435 N C22orf42 n/a
4 TRCN0000420337 GATGGCAAAGGAGAGATATGA pLKO_005 739 CDS 100% 5.625 3.938 N C22orf42 n/a
5 TRCN0000163196 GCTGAAGATGTCCAAAGGTTT pLKO.1 304 CDS 100% 4.950 3.465 N C22orf42 n/a
6 TRCN0000166023 CAGGTCTCAGTGAAAGCCTAT pLKO.1 687 CDS 100% 4.050 2.835 N C22orf42 n/a
7 TRCN0000158483 CCAAATTGGATTTGAAAGCTA pLKO.1 234 CDS 100% 3.000 2.100 N C22orf42 n/a
8 TRCN0000166720 CCATGAGTGTGAGATTCCTGA pLKO.1 169 CDS 100% 2.640 1.848 N C22orf42 n/a
9 TRCN0000162988 GAAGACTTCATGACATCGGAT pLKO.1 623 CDS 100% 2.640 1.848 N C22orf42 n/a
10 TRCN0000438357 GATTACCTCTGCTGGGTTAAG pLKO_005 761 CDS 100% 10.800 5.400 Y C22orf42 n/a
11 TRCN0000161059 GAGGAGAATATGACATCAGAT pLKO.1 437 CDS 100% 4.950 2.475 Y C22orf42 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001010859.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.