Transcript: Human NM_001010926.4

Homo sapiens hes family bHLH transcription factor 5 (HES5), mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
HES5 (388585)
Length:
1324
CDS:
100..600

Additional Resources:

NCBI RefSeq record:
NM_001010926.4
NBCI Gene record:
HES5 (388585)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001010926.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000018151 CGAAGGCTACTCGTGGTGCCT pLKO.1 366 CDS 100% 0.000 0.000 N HES5 n/a
2 TRCN0000018148 CCAGGACTACAGCGAAGGCTA pLKO.1 354 CDS 100% 0.880 0.616 N HES5 n/a
3 TRCN0000018152 GCTGTCAGCTACCTGAAGCAC pLKO.1 292 CDS 100% 0.880 0.616 N HES5 n/a
4 TRCN0000018149 CGCCAGCGACACGCAGATGAA pLKO.1 420 CDS 100% 0.000 0.000 N HES5 n/a
5 TRCN0000018150 CGAGCAGCTGAAGCTGCTGCT pLKO.1 207 CDS 100% 0.000 0.000 Y HES5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001010926.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.