Transcript: Mouse NM_001010930.1

Mus musculus mitochondrial ribosomal protein S33 (Mrps33), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Mrps33 (14548)
Length:
945
CDS:
100..204

Additional Resources:

NCBI RefSeq record:
NM_001010930.1
NBCI Gene record:
Mrps33 (14548)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001010930.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000304922 GCCTTTGTATTCACCATTAAG pLKO_005 683 3UTR 100% 13.200 10.560 N Mrps33 n/a
2 TRCN0000375227 TTTCTGGGACAGGGAGTATTG pLKO_005 741 3UTR 100% 10.800 8.640 N Mrps33 n/a
3 TRCN0000099689 AGAAGGGAAGAGAGCTACAAA pLKO.1 274 3UTR 100% 5.625 3.938 N Mrps33 n/a
4 TRCN0000099686 CAGGACTTTAAGGATGAGCAA pLKO.1 209 3UTR 100% 2.640 1.848 N Mrps33 n/a
5 TRCN0000302667 CAGGACTTTAAGGATGAGCAA pLKO_005 209 3UTR 100% 2.640 1.848 N Mrps33 n/a
6 TRCN0000099687 GTCTACTGACTCAAAGTCCAT pLKO.1 171 CDS 100% 2.640 1.848 N Mrps33 n/a
7 TRCN0000302597 GTCTACTGACTCAAAGTCCAT pLKO_005 171 CDS 100% 2.640 1.848 N Mrps33 n/a
8 TRCN0000099685 GCCTTGTGTATACAAGGTATT pLKO.1 765 3UTR 100% 1.080 0.756 N Mrps33 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001010930.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.