Transcript: Mouse NM_001011534.1

Mus musculus olfactory receptor 988 (Olfr988), mRNA.

Source:
NCBI, updated 2012-08-25
Taxon:
Mus musculus (mouse)
Gene:
Olfr988 (258166)
Length:
930
CDS:
1..930

Additional Resources:

NCBI RefSeq record:
NM_001011534.1
NBCI Gene record:
Olfr988 (258166)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001011534.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000204136 GAGCACTGTACTTGTTGTCAT pLKO.1 624 CDS 100% 4.950 3.960 N Olfr988 n/a
2 TRCN0000187434 GCCCTATCATGCTCCAGTATT pLKO.1 556 CDS 100% 13.200 6.600 Y Olfr987 n/a
3 TRCN0000185978 CCTTTGTTGATCTCTGCTATA pLKO.1 200 CDS 100% 10.800 5.400 Y Olfr987 n/a
4 TRCN0000185838 GCTATTACTCCCAAGATGTTA pLKO.1 226 CDS 100% 5.625 2.813 Y Olfr987 n/a
5 TRCN0000204135 GTCACACTCATGGGTAACATT pLKO.1 109 CDS 100% 5.625 2.813 Y Olfr988 n/a
6 TRCN0000202601 CATTGGAATGATCGTACTCAT pLKO.1 126 CDS 100% 4.950 2.475 Y Olfr987 n/a
7 TRCN0000203045 GCTTCCTAAATGCTTCTGTAA pLKO.1 455 CDS 100% 4.950 2.475 Y Olfr987 n/a
8 TRCN0000204337 CCATGGGCTTCCTAAATGCTT pLKO.1 449 CDS 100% 3.000 1.500 Y Olfr988 n/a
9 TRCN0000188745 GCTGGTGGGTTCTTATACCAT pLKO.1 432 CDS 100% 3.000 1.500 Y Olfr988 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001011534.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.