Transcript: Human NM_001011718.2

Homo sapiens XK related 7 (XKR7), mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
XKR7 (343702)
Length:
7695
CDS:
26..1765

Additional Resources:

NCBI RefSeq record:
NM_001011718.2
NBCI Gene record:
XKR7 (343702)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001011718.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000140352 GATTGACTTGCCTCGCAAGAA pLKO.1 1597 CDS 100% 4.950 6.930 N XKR7 n/a
2 TRCN0000140050 CCAGAGCATAGCGAACAAGAA pLKO.1 2456 3UTR 100% 4.950 3.960 N XKR7 n/a
3 TRCN0000139040 CGACTTCTACTCGCTCATCAT pLKO.1 1255 CDS 100% 4.950 3.960 N XKR7 n/a
4 TRCN0000145300 CGAACAAGAATGAACTCCTTA pLKO.1 2467 3UTR 100% 4.950 3.465 N XKR7 n/a
5 TRCN0000139809 CGTGGGCATCATCTACATCTT pLKO.1 1114 CDS 100% 4.950 3.465 N XKR7 n/a
6 TRCN0000143255 GCAGAATCAACACACCTACTT pLKO.1 274 CDS 100% 4.950 3.465 N XKR7 n/a
7 TRCN0000140310 CCTGCAGAATCAACACACCTA pLKO.1 271 CDS 100% 2.640 1.848 N XKR7 n/a
8 TRCN0000143207 GATCATCTACAACATGGTCGT pLKO.1 1096 CDS 100% 2.160 1.512 N XKR7 n/a
9 TRCN0000126412 GCGCCACTTCTACTGGCAGAT pLKO.1 667 CDS 100% 1.350 0.945 N Xkr7 n/a
10 TRCN0000145108 GAAATGTTTGAAGGAGCCATT pLKO.1 2548 3UTR 100% 4.050 2.430 N XKR7 n/a
11 TRCN0000145149 GCATATTCTTCATGTGTGTCT pLKO.1 1308 CDS 100% 2.640 1.584 N XKR7 n/a
12 TRCN0000126411 CTGGAGTATGAGACCACAGTA pLKO.1 1742 CDS 100% 4.950 3.465 N Xkr7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001011718.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.