Transcript: Human NM_001011719.2

Homo sapiens arylsulfatase family member H (ARSH), mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
ARSH (347527)
Length:
2482
CDS:
68..1756

Additional Resources:

NCBI RefSeq record:
NM_001011719.2
NBCI Gene record:
ARSH (347527)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001011719.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000161520 GCTATGGGAGTGGAATATGTT pLKO.1 1452 CDS 100% 5.625 7.875 N ARSH n/a
2 TRCN0000160927 GCCATTATTTGACTCCGTGAT pLKO.1 1567 CDS 100% 4.050 5.670 N ARSH n/a
3 TRCN0000161768 CGCAGTAAATATGGCAGGTAT pLKO.1 914 CDS 100% 4.950 3.960 N ARSH n/a
4 TRCN0000160589 CCTGACAATGAGCCATTATTT pLKO.1 1556 CDS 100% 15.000 10.500 N ARSH n/a
5 TRCN0000159732 GCTCATTATGTGACTCCTAAA pLKO.1 1406 CDS 100% 10.800 7.560 N ARSH n/a
6 TRCN0000162768 CCACCAGCTTAATGGACATCT pLKO.1 1200 CDS 100% 4.950 3.465 N ARSH n/a
7 TRCN0000163837 CCTCTCGGAATGATCACTGTT pLKO.1 435 CDS 100% 4.950 3.465 N ARSH n/a
8 TRCN0000160695 CTCTCGGAATGATCACTGTTA pLKO.1 436 CDS 100% 4.950 3.465 N ARSH n/a
9 TRCN0000161997 GCTACGGTAATAACTCAGTGA pLKO.1 138 CDS 100% 2.640 1.848 N ARSH n/a
10 TRCN0000161134 CCTGGTACTCTAGTTATGGAT pLKO.1 696 CDS 100% 3.000 1.800 N ARSH n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001011719.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.