Transcript: Human NM_001011720.2

Homo sapiens XK related 9 (XKR9), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
XKR9 (389668)
Length:
3200
CDS:
561..1682

Additional Resources:

NCBI RefSeq record:
NM_001011720.2
NBCI Gene record:
XKR9 (389668)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001011720.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435043 AGGAGATACATAGTAGTATTT pLKO_005 1808 3UTR 100% 13.200 18.480 N XKR9 n/a
2 TRCN0000147120 CTGAGTGTTGTACTTCTACTA pLKO.1 1212 CDS 100% 4.950 6.930 N XKR9 n/a
3 TRCN0000150296 CATATGGGTATCTGTCAGATT pLKO.1 635 CDS 100% 0.000 0.000 N XKR9 n/a
4 TRCN0000413807 GTGTCCAATGTCTTGTTATTA pLKO_005 1412 CDS 100% 15.000 10.500 N XKR9 n/a
5 TRCN0000147709 GATGTCAGTTCTTGGCATTAT pLKO.1 587 CDS 100% 13.200 9.240 N XKR9 n/a
6 TRCN0000147150 CAAACAGAAGTGCAGAAACAA pLKO.1 1594 CDS 100% 5.625 3.938 N XKR9 n/a
7 TRCN0000147496 GATTTAAAGAAAGCAGGCCAA pLKO.1 756 CDS 100% 2.160 1.512 N XKR9 n/a
8 TRCN0000146682 CCAGATTTCATGTGTGTGAAA pLKO.1 2613 3UTR 100% 0.495 0.347 N XKR9 n/a
9 TRCN0000166463 CCTGTGTCCATGTGTTCTCAT pLKO.1 2915 3UTR 100% 4.950 2.475 Y SPC25 n/a
10 TRCN0000148774 CCATGTGTTCTCATTGTTCAA pLKO.1 2922 3UTR 100% 4.950 2.475 Y GLIPR1L2 n/a
11 TRCN0000162188 CCATGTGTTCTCATTGTTCAA pLKO.1 2922 3UTR 100% 4.950 2.475 Y SPC25 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001011720.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.