Transcript: Mouse NM_001011739.1

Mus musculus olfactory receptor 885 (Olfr885), mRNA.

Source:
NCBI, updated 2012-08-25
Taxon:
Mus musculus (mouse)
Gene:
Olfr885 (257885)
Length:
930
CDS:
1..930

Additional Resources:

NCBI RefSeq record:
NM_001011739.1
NBCI Gene record:
Olfr885 (257885)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001011739.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000203393 CTTGGGCTTGATTGTTCTGAT pLKO.1 126 CDS 100% 4.950 2.970 N Olfr885 n/a
2 TRCN0000203346 CCCATGTGATAGCTGTTTCTT pLKO.1 725 CDS 100% 5.625 2.813 Y Olfr885 n/a
3 TRCN0000202630 CATGTACTACTTTCTCTTCAA pLKO.1 174 CDS 100% 4.950 2.475 Y Olfr885 n/a
4 TRCN0000189393 CTGAGACTCACCTTCTGTGAT pLKO.1 487 CDS 100% 4.950 2.475 Y Olfr885 n/a
5 TRCN0000185741 GATTGTTCTGATTGTGTTGAA pLKO.1 135 CDS 100% 4.950 2.475 Y Olfr885 n/a
6 TRCN0000188632 GCTCCCATGTGATAGCTGTTT pLKO.1 722 CDS 100% 4.950 2.475 Y Olfr889 n/a
7 TRCN0000194240 CCTTTCCAACATCCTCAGCAT pLKO.1 660 CDS 100% 2.640 1.320 Y Olfr884 n/a
8 TRCN0000185839 GCTTGATTGTTCTGATTGTTT pLKO.1 131 CDS 100% 5.625 2.813 Y Olfr901 n/a
9 TRCN0000203412 CCCATGTACTACTTTCTCTTT pLKO.1 172 CDS 100% 4.950 2.475 Y Olfr887 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001011739.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.