Transcript: Mouse NM_001011741.2

Mus musculus olfactory receptor 1386 (Olfr1386), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Olfr1386 (257888)
Length:
1128
CDS:
100..1029

Additional Resources:

NCBI RefSeq record:
NM_001011741.2
NBCI Gene record:
Olfr1386 (257888)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001011741.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000188289 CAGCTCCTCATCAACCTCTAT pLKO.1 337 CDS 100% 4.950 2.970 N Olfr1386 n/a
2 TRCN0000186385 CTTTGGCAACACTACCATCAT pLKO.1 216 CDS 100% 4.950 2.970 N Olfr1386 n/a
3 TRCN0000186283 CTTCCTCTCAAATCTCTCCTT pLKO.1 282 CDS 100% 2.640 1.584 N Olfr1386 n/a
4 TRCN0000188465 CCTGAGGAACAAGGATGTGAA pLKO.1 969 CDS 100% 4.950 2.475 Y Olfr156 n/a
5 TRCN0000203744 CTCAGCTGGAACTCATCCTTT pLKO.1 161 CDS 100% 4.950 2.475 Y Olfr1385 n/a
6 TRCN0000203225 GAATCACTTCTTCTGTGAGAT pLKO.1 618 CDS 100% 4.950 2.475 Y Olfr10 n/a
7 TRCN0000187924 GATGCCTGTCTTCCTCAAGTT pLKO.1 636 CDS 100% 4.950 2.475 Y Olfr1385 n/a
8 TRCN0000203515 CAGAGCCATAATCTTGGTCTT pLKO.1 702 CDS 100% 4.050 2.025 Y Olfr1385 n/a
9 TRCN0000185524 GCCATTTACACATACTTGCAA pLKO.1 859 CDS 100% 3.000 1.500 Y Olfr1386 n/a
10 TRCN0000009348 CCCATGTACTTCTTCCTCTCA pLKO.1 271 CDS 100% 2.640 1.320 Y OR2A4 n/a
11 TRCN0000193139 CTCCCTAACTATCTTTGGCAA pLKO.1 204 CDS 100% 2.640 1.320 Y Olfr1385 n/a
12 TRCN0000189143 GACAGGACCATCAGCTATGAA pLKO.1 364 CDS 100% 5.625 2.813 Y Olfr1388 n/a
13 TRCN0000189182 CCCATGTACTTCTTCCTCTCT pLKO.1 271 CDS 100% 2.640 1.320 Y Olfr444 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001011741.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.