Transcript: Mouse NM_001011769.2

Mus musculus olfactory receptor 317 (Olfr317), mRNA.

Source:
NCBI, updated 2013-07-08
Taxon:
Mus musculus (mouse)
Gene:
Olfr317 (257931)
Length:
1128
CDS:
61..1044

Additional Resources:

NCBI RefSeq record:
NM_001011769.2
NBCI Gene record:
Olfr317 (257931)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001011769.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000186626 GACGGCAGAAAGCATTTAATA pLKO.1 758 CDS 100% 15.000 21.000 N Olfr317 n/a
2 TRCN0000204123 GTTACATTGTAAGAGCGGTGT pLKO.1 716 CDS 100% 2.160 1.512 N Olfr317 n/a
3 TRCN0000204814 GCCATTTCATCCTTACTGGCT pLKO.1 89 CDS 100% 0.660 0.462 N Olfr317 n/a
4 TRCN0000204597 CGTTGAAGGCATTGCCTTCAT pLKO.1 642 CDS 100% 0.495 0.347 N Olfr317 n/a
5 TRCN0000189172 CCTCACCCTCTTCTACAACAT pLKO.1 879 CDS 100% 4.950 2.475 Y Olfr317 n/a
6 TRCN0000186043 CGGAAATATCATCTACATGTA pLKO.1 816 CDS 100% 4.950 2.475 Y Olfr317 n/a
7 TRCN0000188492 CCCATGTACTTCTTCCTCACA pLKO.1 232 CDS 100% 2.640 1.320 Y Olfr317 n/a
8 TRCN0000188409 CCTCTGCACTACATGGTCATT pLKO.1 445 CDS 100% 4.950 2.970 N OR7A10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001011769.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.