Transcript: Mouse NM_001011804.1

Mus musculus olfactory receptor 1211 (Olfr1211), mRNA.

Source:
NCBI, updated 2012-08-25
Taxon:
Mus musculus (mouse)
Gene:
Olfr1211 (258025)
Length:
936
CDS:
1..936

Additional Resources:

NCBI RefSeq record:
NM_001011804.1
NBCI Gene record:
Olfr1211 (258025)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001011804.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000202550 CTGCACTGATACTCATATCTT pLKO.1 561 CDS 100% 5.625 3.938 N Olfr1211 n/a
2 TRCN0000203380 CAGAACCCTAAAGTCCAGAAA pLKO.1 49 CDS 100% 4.950 3.465 N Olfr1211 n/a
3 TRCN0000185980 CGATCATTTCATGTGTGACTT pLKO.1 519 CDS 100% 4.950 3.465 N Olfr1211 n/a
4 TRCN0000204267 CCCACATTGCAGTTGTGGTTT pLKO.1 722 CDS 100% 0.495 0.297 N Olfr1211 n/a
5 TRCN0000030343 GCAACATGATAATTGTGGTAA pLKO.1 116 CDS 100% 4.950 2.475 Y Olfr1213 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001011804.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.