Transcript: Mouse NM_001011805.1

Mus musculus olfactory receptor 1385 (Olfr1385), mRNA.

Source:
NCBI, updated 2018-05-27
Taxon:
Mus musculus (mouse)
Gene:
Olfr1385 (258027)
Length:
930
CDS:
1..930

Additional Resources:

NCBI RefSeq record:
NM_001011805.1
NBCI Gene record:
Olfr1385 (258027)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001011805.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000188465 CCTGAGGAACAAGGATGTGAA pLKO.1 870 CDS 100% 4.950 2.475 Y Olfr156 n/a
2 TRCN0000203744 CTCAGCTGGAACTCATCCTTT pLKO.1 62 CDS 100% 4.950 2.475 Y Olfr1385 n/a
3 TRCN0000203225 GAATCACTTCTTCTGTGAGAT pLKO.1 519 CDS 100% 4.950 2.475 Y Olfr10 n/a
4 TRCN0000187924 GATGCCTGTCTTCCTCAAGTT pLKO.1 537 CDS 100% 4.950 2.475 Y Olfr1385 n/a
5 TRCN0000203515 CAGAGCCATAATCTTGGTCTT pLKO.1 603 CDS 100% 4.050 2.025 Y Olfr1385 n/a
6 TRCN0000185524 GCCATTTACACATACTTGCAA pLKO.1 760 CDS 100% 3.000 1.500 Y Olfr1386 n/a
7 TRCN0000193139 CTCCCTAACTATCTTTGGCAA pLKO.1 105 CDS 100% 2.640 1.320 Y Olfr1385 n/a
8 TRCN0000189143 GACAGGACCATCAGCTATGAA pLKO.1 265 CDS 100% 5.625 2.813 Y Olfr1388 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001011805.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.