Transcript: Mouse NM_001011830.2

Mus musculus olfactory receptor 119 (Olfr119), mRNA.

Source:
NCBI, updated 2013-04-17
Taxon:
Mus musculus (mouse)
Gene:
Olfr119 (258095)
Length:
1033
CDS:
68..1033

Additional Resources:

NCBI RefSeq record:
NM_001011830.2
NBCI Gene record:
Olfr119 (258095)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001011830.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000188387 CACCAATCCATCCCTACACAA pLKO.1 235 CDS 100% 4.950 3.465 N Olfr119 n/a
2 TRCN0000185842 GAGAATGCTTCCTCCTATTTA pLKO.1 150 CDS 100% 15.000 9.000 N Olfr119 n/a
3 TRCN0000185557 CTCAGCATCTATTACTTACTT pLKO.1 844 CDS 100% 5.625 3.375 N Olfr119 n/a
4 TRCN0000202988 CTTAGTATCACTGACAGGAAA pLKO.1 190 CDS 100% 4.950 2.475 Y Olfr129 n/a
5 TRCN0000188164 CAACTTGTCTCTCCTGGAGAT pLKO.1 277 CDS 100% 4.050 2.025 Y Olfr119 n/a
6 TRCN0000187251 CCAACTTGTCTCTCCTGGAAA pLKO.1 276 CDS 100% 4.950 2.475 Y Olfr120 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001011830.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.