Transcript: Mouse NM_001011848.1

Mus musculus olfactory receptor 675 (Olfr675), mRNA.

Source:
NCBI, updated 2018-05-27
Taxon:
Mus musculus (mouse)
Gene:
Olfr675 (258147)
Length:
942
CDS:
1..942

Additional Resources:

NCBI RefSeq record:
NM_001011848.1
NBCI Gene record:
Olfr675 (258147)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001011848.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000186070 CTATACATGGTTCTTCCAGTA pLKO.1 463 CDS 100% 4.050 2.835 N Olfr675 n/a
2 TRCN0000187381 CCGCTACGTTGCCATTTGTAA pLKO.1 369 CDS 100% 5.625 3.375 N Olfr675 n/a
3 TRCN0000202775 CCTGGATGTAGTTCTTATTAT pLKO.1 627 CDS 100% 15.000 7.500 Y Olfr675 n/a
4 TRCN0000186107 CTCCTTCTTGACACATCGTTT pLKO.1 774 CDS 100% 4.950 2.475 Y Olfr675 n/a
5 TRCN0000185596 GTCAACATCATGTTTGGTCTT pLKO.1 586 CDS 100% 4.050 2.025 Y Olfr671 n/a
6 TRCN0000060815 GCCAGCATCAAAGTCAACATT pLKO.1 574 CDS 100% 5.625 2.813 Y OR52E8 n/a
7 TRCN0000204164 GCCAGCATCAAAGTCAACATT pLKO.1 574 CDS 100% 5.625 2.813 Y OR52E6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001011848.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.