Transcript: Human NM_001012502.3

Homo sapiens cilia and flagella associated protein 157 (CFAP157), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
CFAP157 (286207)
Length:
3704
CDS:
45..1607

Additional Resources:

NCBI RefSeq record:
NM_001012502.3
NBCI Gene record:
CFAP157 (286207)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001012502.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000264176 ACCTCAGGCTGCTGTCATATA pLKO_005 1474 CDS 100% 13.200 9.240 N CFAP157 n/a
2 TRCN0000282939 GTTTGAGCAGCTGGCCAATAA pLKO_005 260 CDS 100% 13.200 9.240 N CFAP157 n/a
3 TRCN0000264174 CTACAGCAGGAACTGGCTAAT pLKO_005 1089 CDS 100% 10.800 7.560 N CFAP157 n/a
4 TRCN0000264173 TCAAAGAGAACAACGGCATTA pLKO_005 727 CDS 100% 10.800 7.560 N CFAP157 n/a
5 TRCN0000179755 GAACGGAGCTTCAAGAAGTTT pLKO.1 3091 3UTR 100% 5.625 3.938 N CFAP157 n/a
6 TRCN0000180465 GAGCACTGAACTCACCAGTTA pLKO.1 3122 3UTR 100% 4.950 3.465 N CFAP157 n/a
7 TRCN0000264175 AGAATGAGTTCAGGGACTATG pLKO_005 571 CDS 100% 10.800 6.480 N CFAP157 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001012502.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.