Transcript: Human NM_001012728.1

Homo sapiens divergent-paired related homeobox (DPRX), mRNA.

Source:
NCBI, updated 2019-09-23
Taxon:
Homo sapiens (human)
Gene:
DPRX (503834)
Length:
648
CDS:
52..627

Additional Resources:

NCBI RefSeq record:
NM_001012728.1
NBCI Gene record:
DPRX (503834)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001012728.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000107621 CAGAAAGAAATGGCCTCGAAA pLKO.1 187 CDS 100% 4.950 2.970 N DPRX n/a
2 TRCN0000107623 GAAACTCCACAACCGCCAATA pLKO.1 301 CDS 100% 10.800 5.400 Y DPRX n/a
3 TRCN0000107624 CTGAGAAATGCAGACACACTA pLKO.1 352 CDS 100% 4.950 2.475 Y DPRX n/a
4 TRCN0000107622 CCAGATGCATTCACACAGGAA pLKO.1 87 CDS 100% 2.640 1.320 Y DPRX n/a
5 TRCN0000107620 GATCTGAACATCTTGTTCAAT pLKO.1 139 CDS 100% 0.563 0.281 Y DPRX n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001012728.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.