Transcript: Mouse NM_001012765.4

Mus musculus adenylate cyclase 5 (Adcy5), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Adcy5 (224129)
Length:
5060
CDS:
464..4252

Additional Resources:

NCBI RefSeq record:
NM_001012765.4
NBCI Gene record:
Adcy5 (224129)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001012765.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000442932 AGAAGTTCCCGTCGGACAAAC pLKO_005 1122 CDS 100% 10.800 15.120 N ADCY5 n/a
2 TRCN0000110754 AGAATCACTGTTTACGGATTA pLKO.1 1986 CDS 100% 10.800 15.120 N Adcy5 n/a
3 TRCN0000110751 CCAGATGAAGATTGGGCTCAA pLKO.1 3985 CDS 100% 4.050 3.240 N Adcy5 n/a
4 TRCN0000110750 CCAGGTTACTACAGATATGTA pLKO.1 4120 CDS 100% 5.625 3.938 N Adcy5 n/a
5 TRCN0000110753 GCCACACTCAACTACCTGAAT pLKO.1 2291 CDS 100% 4.950 3.465 N Adcy5 n/a
6 TRCN0000110752 GCTGCAGATATTCCGCTCTAA pLKO.1 1102 CDS 100% 4.950 3.465 N Adcy5 n/a
7 TRCN0000138213 CCAGGAAGATAGTGCGATCAT pLKO.1 2937 CDS 100% 4.950 3.465 N ZBTB5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001012765.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.