Transcript: Mouse NM_001013360.2

Mus musculus neuronal pentraxin chromo domain (Npcd), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-04-28
Taxon:
Mus musculus (mouse)
Gene:
Npcd (504193)
Length:
4600
CDS:
123..1241

Additional Resources:

NCBI RefSeq record:
NM_001013360.2
NBCI Gene record:
Npcd (504193)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001013360.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219475 CTTGGTCTCTCCCATCATATA pLKO.1 1498 3UTR 100% 13.200 6.600 Y Nptxr n/a
2 TRCN0000019065 GCATCGAGTACCTGGTGAAAT pLKO.1 196 CDS 100% 13.200 6.600 Y CBX6 n/a
3 TRCN0000343456 GCATCGAGTACCTGGTGAAAT pLKO_005 196 CDS 100% 13.200 6.600 Y CBX6 n/a
4 TRCN0000219473 CAAGCCACACGGCATCCTTAT pLKO.1 980 CDS 100% 10.800 5.400 Y Nptxr n/a
5 TRCN0000219472 GACAGCAACTGGCACCATATC pLKO.1 864 CDS 100% 10.800 5.400 Y Nptxr n/a
6 TRCN0000219474 GATACCTTGGGAGGCCGATTT pLKO.1 1017 CDS 100% 10.800 5.400 Y Nptxr n/a
7 TRCN0000195811 CACTCCAAGATGGACGAACTA pLKO.1 432 CDS 100% 4.950 2.475 Y Npcd n/a
8 TRCN0000180973 CAGAGGAGAACATTCTGGATT pLKO.1 253 CDS 100% 4.950 2.475 Y Npcd n/a
9 TRCN0000195742 CGTTGGTGACATTGCACAGTT pLKO.1 1055 CDS 100% 4.950 2.475 Y Npcd n/a
10 TRCN0000176234 GAGTACCTGGTGAAATGGAAA pLKO.1 201 CDS 100% 4.950 2.475 Y Cbx6 n/a
11 TRCN0000096753 CATTCTGGATTCGAGGCTCAT pLKO.1 263 CDS 100% 4.050 2.025 Y Cbx6 n/a
12 TRCN0000181119 CCAAGATGGACGAACTAGAAT pLKO.1 436 CDS 100% 5.625 2.813 Y Npcd n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001013360.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.