Transcript: Mouse NM_001013382.2

Mus musculus leucine rich repeat containing 52 (Lrrc52), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Lrrc52 (240899)
Length:
1167
CDS:
67..1011

Additional Resources:

NCBI RefSeq record:
NM_001013382.2
NBCI Gene record:
Lrrc52 (240899)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001013382.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000253453 TTCGAGAGGTGATGGATTATA pLKO_005 332 CDS 100% 15.000 21.000 N Lrrc52 n/a
2 TRCN0000253450 ACGGAATACCCAGCTGATATT pLKO_005 199 CDS 100% 13.200 18.480 N Lrrc52 n/a
3 TRCN0000253451 TCTGAACACCCGGAGACTATA pLKO_005 222 CDS 100% 13.200 18.480 N Lrrc52 n/a
4 TRCN0000253454 TTGCACATCATCGACCATAAT pLKO_005 550 CDS 100% 13.200 10.560 N Lrrc52 n/a
5 TRCN0000193429 GACTTCACCATCCACTTATTA pLKO.1 646 CDS 100% 15.000 10.500 N Lrrc52 n/a
6 TRCN0000253452 GACTTCACCATCCACTTATTA pLKO_005 646 CDS 100% 15.000 10.500 N Lrrc52 n/a
7 TRCN0000217767 GAAGTAGCCTGCATAGATTTG pLKO.1 172 CDS 100% 10.800 7.560 N Lrrc52 n/a
8 TRCN0000173947 GAGTAGATTCGCCAACCAGAT pLKO.1 936 CDS 100% 4.050 2.835 N Lrrc52 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001013382.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.