Transcript: Mouse NM_001013411.2

Mus musculus Na+/K+ transporting ATPase interacting 2 (Nkain2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Nkain2 (432450)
Length:
3205
CDS:
220..846

Additional Resources:

NCBI RefSeq record:
NM_001013411.2
NBCI Gene record:
Nkain2 (432450)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001013411.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000265582 GGCACCTATCCTGGCAAATTT pLKO_005 321 CDS 100% 15.000 21.000 N Nkain2 n/a
2 TRCN0000174713 GCTTATCTTTATCTGTGGCAT pLKO.1 246 CDS 100% 2.640 3.696 N Nkain2 n/a
3 TRCN0000254545 AGACCTTATCCTGACATTTAA pLKO_005 498 CDS 100% 15.000 12.000 N Nkain2 n/a
4 TRCN0000265565 TCGTCATCCTTGGGTTGTTTG pLKO_005 356 CDS 100% 10.800 8.640 N Nkain2 n/a
5 TRCN0000193416 CCCATCCTAGATTTCCTTAAT pLKO.1 1093 3UTR 100% 13.200 9.240 N Nkain2 n/a
6 TRCN0000194522 GCCTCAGAAGACATCTCACTT pLKO.1 795 CDS 100% 4.950 3.465 N Nkain2 n/a
7 TRCN0000172897 GCTCATAGTTCCCTCCAGATT pLKO.1 664 CDS 100% 4.950 3.465 N NKAIN2 n/a
8 TRCN0000254546 TGTTATGTTGTGAGATGTATA pLKO_005 715 CDS 100% 13.200 7.920 N Nkain2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001013411.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.