Transcript: Human NM_001013619.4

Homo sapiens hydroxylysine kinase (HYKK), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-08
Taxon:
Homo sapiens (human)
Gene:
HYKK (123688)
Length:
4197
CDS:
101..1222

Additional Resources:

NCBI RefSeq record:
NM_001013619.4
NBCI Gene record:
HYKK (123688)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001013619.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000127991 GAGTCAGTGTTTGGGTTGAAA pLKO.1 179 CDS 100% 5.625 3.938 N HYKK n/a
2 TRCN0000130973 CCCACTTTCAGTGAGGAACAA pLKO.1 143 CDS 100% 4.950 3.465 N HYKK n/a
3 TRCN0000129300 CGGGAGAACTTCATCTGGAAT pLKO.1 611 CDS 100% 4.950 3.465 N HYKK n/a
4 TRCN0000127707 GACCTGATTGAAGTGCAGAAT pLKO.1 326 CDS 100% 4.950 3.465 N HYKK n/a
5 TRCN0000129483 GCTTCTCTCGTGTCTGTAGAT pLKO.1 419 CDS 100% 4.950 3.465 N HYKK n/a
6 TRCN0000127486 CTAAAGGAGACAACACAGCTT pLKO.1 402 CDS 100% 2.640 1.848 N HYKK n/a
7 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2060 3UTR 100% 5.625 2.813 Y KLHL30 n/a
8 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3852 3UTR 100% 4.950 2.475 Y KAAG1 n/a
9 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2060 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001013619.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.