Transcript: Human NM_001013732.3

Homo sapiens patched domain containing 4 (PTCHD4), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
PTCHD4 (442213)
Length:
2850
CDS:
35..2575

Additional Resources:

NCBI RefSeq record:
NM_001013732.3
NBCI Gene record:
PTCHD4 (442213)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001013732.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000149816 GAAGTGCCAAACAGCAAAGAT pLKO.1 506 CDS 100% 5.625 3.938 N PTCHD4 n/a
2 TRCN0000129218 CTTCTTCATCACCGATGGAAA pLKO.1 880 CDS 100% 4.950 3.465 N PTCHD4 n/a
3 TRCN0000183357 GCCAACATCATCAATCTACTA pLKO.1 1499 CDS 100% 4.950 3.465 N PTCHD4 n/a
4 TRCN0000150149 GAGAATGAGTTCTGTAAGCTT pLKO.1 617 CDS 100% 3.000 2.100 N PTCHD4 n/a
5 TRCN0000128775 CAGAGCCATTCAAATCACCTA pLKO.1 544 CDS 100% 2.640 1.848 N PTCHD4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001013732.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.