Transcript: Mouse NM_001013759.2

Mus musculus growth arrest-specific 2 like 2 (Gas2l2), mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Gas2l2 (237891)
Length:
2943
CDS:
94..2676

Additional Resources:

NCBI RefSeq record:
NM_001013759.2
NBCI Gene record:
Gas2l2 (237891)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001013759.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000177639 CCAGAAGATCCCATCCATTTA pLKO.1 2337 CDS 100% 13.200 9.240 N Gas2l2 n/a
2 TRCN0000182109 CAGGGACAACATCTCCAACTT pLKO.1 423 CDS 100% 4.950 3.465 N Gas2l2 n/a
3 TRCN0000200174 CCAGGTGAATGGAACAGGTAA pLKO.1 2526 CDS 100% 4.950 3.465 N Gas2l2 n/a
4 TRCN0000198072 CTCCAACACTCTCATCTTCAT pLKO.1 804 CDS 100% 4.950 3.465 N Gas2l2 n/a
5 TRCN0000178242 GCAATTCTCCATGGTCAAGAT pLKO.1 756 CDS 100% 4.950 3.465 N Gas2l2 n/a
6 TRCN0000176881 GATAACCTTAAAGAGGAGGTT pLKO.1 1852 CDS 100% 0.264 0.185 N Gas2l2 n/a
7 TRCN0000217083 CTGGGCCATTATCTGGATAAA pLKO.1 877 CDS 100% 13.200 7.920 N Gas2l2 n/a
8 TRCN0000197984 CCTCCTTAAAGTGGATCTGAA pLKO.1 2040 CDS 100% 4.950 2.970 N Gas2l2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001013759.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.