Transcript: Mouse NM_001013813.3

Mus musculus mastermind like 2 (Drosophila) (Maml2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Maml2 (270118)
Length:
6548
CDS:
107..3619

Additional Resources:

NCBI RefSeq record:
NM_001013813.3
NBCI Gene record:
Maml2 (270118)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001013813.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000254033 CAATCGAAGCTTCATTAATAA pLKO_005 1711 CDS 100% 15.000 12.000 N Maml2 n/a
2 TRCN0000226152 CATGATCAATGCTACCATTAA pLKO_005 1075 CDS 100% 13.200 10.560 N Maml2 n/a
3 TRCN0000226153 GTCTAAAGCAGCGGCCAATTA pLKO_005 1618 CDS 100% 13.200 10.560 N Maml2 n/a
4 TRCN0000226154 CCAAATGAATCAGGCATTAAA pLKO_005 3238 CDS 100% 15.000 10.500 N Maml2 n/a
5 TRCN0000218317 CTCCTCTACAGTGAGTTTAAA pLKO_005 2611 CDS 100% 15.000 10.500 N Maml2 n/a
6 TRCN0000226155 GAAGCTATCCAGCAGATTAAT pLKO_005 4115 3UTR 100% 15.000 10.500 N Maml2 n/a
7 TRCN0000254031 CAACAGCCTGTATCGAATTTC pLKO_005 4335 3UTR 100% 13.200 9.240 N Maml2 n/a
8 TRCN0000254032 CCTGATCATGGCAGTGATTTA pLKO_005 3446 CDS 100% 13.200 9.240 N Maml2 n/a
9 TRCN0000254030 TGCCCATGGAGAAGATCATTA pLKO_005 1161 CDS 100% 13.200 9.240 N Maml2 n/a
10 TRCN0000254034 CAATGAACTAACCAACATATC pLKO_005 1021 CDS 100% 10.800 7.560 N Maml2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001013813.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12817 pDONR223 100% 83% 82.7% None (many diffs) n/a
2 ccsbBroad304_12817 pLX_304 0% 83% 82.7% V5 (many diffs) n/a
Download CSV