Transcript: Human NM_001014841.1

Homo sapiens neurochondrin (NCDN), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-23
Taxon:
Homo sapiens (human)
Gene:
NCDN (23154)
Length:
3378
CDS:
111..2249

Additional Resources:

NCBI RefSeq record:
NM_001014841.1
NBCI Gene record:
NCDN (23154)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001014841.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000156744 GTGCAAGTATTTCCTGCAGCA pLKO.1 1529 CDS 100% 2.160 1.728 N NCDN n/a
2 TRCN0000156254 CAAGAATGACAGCGAGCAGTT pLKO.1 197 CDS 100% 4.050 2.835 N NCDN n/a
3 TRCN0000157486 GCAGGTGACATAGATGCCAAA pLKO.1 252 CDS 100% 4.050 2.835 N NCDN n/a
4 TRCN0000153311 GTCCTGAACAAGATTCCCATT pLKO.1 435 CDS 100% 4.050 2.835 N NCDN n/a
5 TRCN0000156435 CCATCCTCTTCCTATCACAGT pLKO.1 1855 CDS 100% 2.640 1.848 N NCDN n/a
6 TRCN0000153241 GATTCCCATTCTTAGCACCTT pLKO.1 446 CDS 100% 2.640 1.848 N NCDN n/a
7 TRCN0000153259 GATTTCCAGAAAGCTGAGGAT pLKO.1 741 CDS 100% 2.640 1.848 N NCDN n/a
8 TRCN0000153711 CACATCTCTAATGAACACCCT pLKO.1 1685 CDS 100% 0.660 0.462 N NCDN n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3216 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001014841.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.