Transcript: Mouse NM_001014981.1

Mus musculus WD repeat domain 7 (Wdr7), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Wdr7 (104082)
Length:
7109
CDS:
239..4708

Additional Resources:

NCBI RefSeq record:
NM_001014981.1
NBCI Gene record:
Wdr7 (104082)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001014981.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000231265 ATGACCAAAGATACCTGATAT pLKO_005 1677 CDS 100% 13.200 18.480 N Wdr7 n/a
2 TRCN0000231267 AGTTTAGGAGCAAGCATATTT pLKO_005 5441 3UTR 100% 15.000 10.500 N Wdr7 n/a
3 TRCN0000231263 CAGGATACTGAGCCAATATTT pLKO_005 833 CDS 100% 15.000 10.500 N Wdr7 n/a
4 TRCN0000231266 CTGATGCTTCCCGGTTATAAT pLKO_005 2774 CDS 100% 15.000 10.500 N Wdr7 n/a
5 TRCN0000231264 GATTCTTCTGGAAGGTTAAAT pLKO_005 1280 CDS 100% 15.000 10.500 N Wdr7 n/a
6 TRCN0000430162 GTCATAATTTGGGACATATTT pLKO_005 1718 CDS 100% 15.000 10.500 N WDR7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001014981.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11721 pDONR223 100% 46.1% 47.2% None (many diffs) n/a
2 ccsbBroad304_11721 pLX_304 0% 46.1% 47.2% V5 (many diffs) n/a
Download CSV