Transcript: Human NM_001017363.2

Homo sapiens AT-rich interaction domain 3C (ARID3C), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
ARID3C (138715)
Length:
1720
CDS:
73..1311

Additional Resources:

NCBI RefSeq record:
NM_001017363.2
NBCI Gene record:
ARID3C (138715)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001017363.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000201971 CAGTGGCATCAGCAGTATCAA pLKO.1 1155 CDS 100% 5.625 3.938 N Arid3c n/a
2 TRCN0000148133 GAACAATTCAAGCAGCTGTAT pLKO.1 376 CDS 100% 4.950 3.465 N ARID3C n/a
3 TRCN0000147748 GAATTTCTGGATGACCTGTTT pLKO.1 424 CDS 100% 4.950 3.465 N ARID3C n/a
4 TRCN0000180749 GTGGAAGTCATCAACCGCAAA pLKO.1 553 CDS 100% 4.050 2.835 N ARID3C n/a
5 TRCN0000433215 TTACACCGCTACTCCGCTCTT pLKO_005 756 CDS 100% 4.050 2.835 N ARID3C n/a
6 TRCN0000415786 ACGGGAGAAATTGGCACCAGA pLKO_005 999 CDS 100% 2.640 1.848 N ARID3C n/a
7 TRCN0000147052 CCTATTAAGAAAGAGGAGAGT pLKO.1 925 CDS 100% 2.640 1.848 N ARID3C n/a
8 TRCN0000179331 GAAGAGGAAGATGCTGAAGAA pLKO.1 226 CDS 100% 4.950 2.970 N ARID3C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001017363.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.