Transcript: Human NM_001017962.2

Homo sapiens prolyl 4-hydroxylase subunit alpha 1 (P4HA1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-08
Taxon:
Homo sapiens (human)
Gene:
P4HA1 (5033)
Length:
2860
CDS:
242..1846

Additional Resources:

NCBI RefSeq record:
NM_001017962.2
NBCI Gene record:
P4HA1 (5033)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001017962.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000303934 ATTTGAGCTATGCGGTATATC pLKO_005 870 CDS 100% 13.200 18.480 N P4HA1 n/a
2 TRCN0000061998 GCGAGATTTCTACCATAGATA pLKO.1 831 CDS 100% 5.625 7.875 N P4HA1 n/a
3 TRCN0000061999 CCTCGTATTATTCGCTTCCAT pLKO.1 1244 CDS 100% 3.000 4.200 N P4HA1 n/a
4 TRCN0000062001 GCAGAGAAGTTAGATCGGCTA pLKO.1 419 CDS 100% 2.160 1.728 N P4HA1 n/a
5 TRCN0000062000 CCAGTGGAGAAGGAGATTATA pLKO.1 1710 CDS 100% 15.000 10.500 N P4HA1 n/a
6 TRCN0000303933 CCTGTGGTGTCTCGAATTAAT pLKO_005 1415 CDS 100% 15.000 10.500 N P4HA1 n/a
7 TRCN0000303872 AGTAACACGAAATCATCATAT pLKO_005 2022 3UTR 100% 13.200 9.240 N P4HA1 n/a
8 TRCN0000062002 CCAGTGCTAGTTGGCAACAAA pLKO.1 1751 CDS 100% 5.625 3.938 N P4HA1 n/a
9 TRCN0000300172 CCAGTGCTAGTTGGCAACAAA pLKO_005 1751 CDS 100% 5.625 3.938 N P4HA1 n/a
10 TRCN0000303935 CTATACAGAAGCAGATTATTA pLKO_005 763 CDS 100% 15.000 9.000 N P4HA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001017962.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.