Transcript: Human NM_001017981.2

Homo sapiens ring finger protein 215 (RNF215), mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
RNF215 (200312)
Length:
2011
CDS:
99..1232

Additional Resources:

NCBI RefSeq record:
NM_001017981.2
NBCI Gene record:
RNF215 (200312)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001017981.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000122323 CCAGTGATCGTCCTCCATTAT pLKO.1 627 CDS 100% 13.200 18.480 N RNF215 n/a
2 TRCN0000122845 GAACCGCTACTCCGATGATTA pLKO.1 1211 CDS 100% 13.200 18.480 N RNF215 n/a
3 TRCN0000140929 CTGCCAATATCGAGTGGAAGT pLKO.1 730 CDS 100% 4.050 5.670 N RNF215 n/a
4 TRCN0000139432 CCAGTTCCACCAGGAGAATAA pLKO.1 464 CDS 100% 13.200 9.240 N RNF215 n/a
5 TRCN0000139703 CTGCCCACTGTGCAAATTCAA pLKO.1 1181 CDS 100% 5.625 3.938 N RNF215 n/a
6 TRCN0000121965 CAGGTCAATAAGGAAAGAGAA pLKO.1 1521 3UTR 100% 4.950 3.465 N RNF215 n/a
7 TRCN0000143871 CCGTCTTTCAGGATACTTCTT pLKO.1 1699 3UTR 100% 4.950 3.465 N RNF215 n/a
8 TRCN0000140589 GTCAAGGAAGAGAGGTCACTT pLKO.1 1445 3UTR 100% 4.950 3.465 N RNF215 n/a
9 TRCN0000139565 CCCACTGTGCAAATTCAACGT pLKO.1 1184 CDS 100% 2.640 1.848 N RNF215 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001017981.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.