Transcript: Mouse NM_001024604.2

Mus musculus ankyrin repeat domain 28 (Ankrd28), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Ankrd28 (105522)
Length:
5229
CDS:
63..3224

Additional Resources:

NCBI RefSeq record:
NM_001024604.2
NBCI Gene record:
Ankrd28 (105522)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001024604.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000119373 CGGGACAAACAAGGCTATAAT pLKO.1 1563 CDS 100% 15.000 12.000 N Ankrd28 n/a
2 TRCN0000119374 GCTTCTAATCAACACTCTTAT pLKO.1 1118 CDS 100% 13.200 10.560 N Ankrd28 n/a
3 TRCN0000119376 CCGTTATACCAACACCTCAAA pLKO.1 3065 CDS 100% 4.950 3.960 N Ankrd28 n/a
4 TRCN0000119375 GCCAGAATGCTCAGGTCAATT pLKO.1 2593 CDS 100% 13.200 9.240 N Ankrd28 n/a
5 TRCN0000119372 GCCAAATTGAAGACTGCCTTT pLKO.1 4778 3UTR 100% 4.050 2.835 N Ankrd28 n/a
6 TRCN0000089693 GCTTCCTAAGTGCTGGGATTA pLKO.1 4517 3UTR 100% 10.800 5.400 Y Rnd1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001024604.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.