Transcript: Mouse NM_001024721.2

Mus musculus interferon activated gene 214 (Ifi214), mRNA.

Source:
NCBI, updated 2016-09-08
Taxon:
Mus musculus (mouse)
Gene:
Ifi214 (545384)
Length:
1294
CDS:
307..966

Additional Resources:

NCBI RefSeq record:
NM_001024721.2
NBCI Gene record:
Ifi214 (545384)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001024721.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000229586 GCTTTGGAAATGGTCCTTATT pLKO_005 1109 3UTR 100% 13.200 9.240 N Ifi214 n/a
2 TRCN0000229584 TGAATACGACAGAGTTAAGAT pLKO_005 426 CDS 100% 5.625 3.938 N Ifi214 n/a
3 TRCN0000229585 AGATCATCCAGCAGGATTCTG pLKO_005 850 CDS 100% 4.950 3.465 N Ifi214 n/a
4 TRCN0000254929 GTGTCTCCAGGAACAGCATAT pLKO_005 880 CDS 100% 10.800 6.480 N Ifi214 n/a
5 TRCN0000218441 CAGGTTGCTCAGTTATCTTTA pLKO_005 703 CDS 100% 13.200 6.600 Y Ifi214 n/a
6 TRCN0000095201 CCATTCAAATTTCTCCAACAA pLKO.1 749 CDS 100% 4.950 2.475 Y Ifi209 n/a
7 TRCN0000095199 GCTTCCTTTATGAAACTGCAT pLKO.1 986 3UTR 100% 2.640 1.320 Y Ifi209 n/a
8 TRCN0000166364 CACACACACACACACACACAA pLKO.1 101 5UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001024721.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.