Transcript: Mouse NM_001024728.2

Mus musculus RIKEN cDNA C330021F23 gene (C330021F23Rik), mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
C330021F23Rik (546049)
Length:
1621
CDS:
674..1099

Additional Resources:

NCBI RefSeq record:
NM_001024728.2
NBCI Gene record:
C330021F23Rik (546049)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001024728.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000283912 GACACTGGGAGGCACTGATAA pLKO_005 1363 3UTR 100% 13.200 9.240 N C330021F23Rik n/a
2 TRCN0000269167 CTTGTGCCACATCAGACAATC pLKO_005 1437 3UTR 100% 10.800 7.560 N C330021F23Rik n/a
3 TRCN0000269114 TCTGCAAACTTACAGAGTAAC pLKO_005 1318 3UTR 100% 10.800 7.560 N C330021F23Rik n/a
4 TRCN0000269165 ATGACCTGGCCTTGATCTGTT pLKO_005 1116 3UTR 100% 4.950 3.465 N C330021F23Rik n/a
5 TRCN0000202113 CCAGCACAATTCCCTTTGCAT pLKO.1 919 CDS 100% 3.000 1.500 Y Gm5148 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001024728.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.