Transcript: Mouse NM_001024806.2

Mus musculus CCAAT/enhancer binding protein zeta (Cebpz), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Cebpz (12607)
Length:
4091
CDS:
41..3199

Additional Resources:

NCBI RefSeq record:
NM_001024806.2
NBCI Gene record:
Cebpz (12607)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001024806.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000231249 GACTGATACTGTGGTATTATG pLKO_005 1026 CDS 100% 13.200 10.560 N Cebpz n/a
2 TRCN0000231252 AGCTGTTCTCATCTAAGTAAT pLKO_005 3812 3UTR 100% 13.200 9.240 N Cebpz n/a
3 TRCN0000231250 AGGCTACTCTTCCGCTCAAAT pLKO_005 1316 CDS 100% 13.200 9.240 N Cebpz n/a
4 TRCN0000338461 AGGCTACTCTTCCGCTCAAAT pLKO_005 1316 CDS 100% 13.200 9.240 N CEBPZ n/a
5 TRCN0000231248 TGGAGTACAGCGGTGAGTATT pLKO_005 597 CDS 100% 13.200 9.240 N Cebpz n/a
6 TRCN0000231251 GATCGATTTGTGTACCGAAAT pLKO_005 2312 CDS 100% 10.800 7.560 N Cebpz n/a
7 TRCN0000071671 CCCGATGTGTTTGAATTTCTA pLKO.1 530 CDS 100% 5.625 3.938 N Cebpz n/a
8 TRCN0000071670 CCCGTCTCCAAAGCAAAGAAA pLKO.1 500 CDS 100% 5.625 3.938 N Cebpz n/a
9 TRCN0000071672 GCACGAAGTCAGCTTATTCAA pLKO.1 682 CDS 100% 5.625 3.938 N Cebpz n/a
10 TRCN0000071668 CGGAGGCACAAAGCAAGATTA pLKO.1 184 CDS 100% 13.200 7.920 N Cebpz n/a
11 TRCN0000071669 GCTCTTCTTGTGCAGGTGATA pLKO.1 1184 CDS 100% 4.950 2.970 N Cebpz n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001024806.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.