Transcript: Mouse NM_001025067.2

Mus musculus leucine-rich repeats and immunoglobulin-like domains 2 (Lrig2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Lrig2 (269473)
Length:
7196
CDS:
228..3392

Additional Resources:

NCBI RefSeq record:
NM_001025067.2
NBCI Gene record:
Lrig2 (269473)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001025067.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000106503 CCGGTTGTCTAACTGGAACAA pLKO.1 479 CDS 100% 4.950 6.930 N Lrig2 n/a
2 TRCN0000106504 CGAATGTTACAGCAACTGTAT pLKO.1 1083 CDS 100% 4.950 3.465 N Lrig2 n/a
3 TRCN0000106500 GCCCTGTATTTGTTCTCCTTA pLKO.1 6197 3UTR 100% 4.950 3.465 N Lrig2 n/a
4 TRCN0000106501 CGCCTTGATGAATCTGCCTTT pLKO.1 1197 CDS 100% 4.050 2.835 N Lrig2 n/a
5 TRCN0000106502 GCAGGTTACATGACCATGCTT pLKO.1 3322 CDS 100% 3.000 2.100 N Lrig2 n/a
6 TRCN0000154308 CCACCAACCATGAGAGGATAA pLKO.1 3139 CDS 100% 10.800 8.640 N LRIG2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001025067.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.