Transcript: Human NM_001025107.3

Homo sapiens adenosine deaminase RNA specific (ADAR), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-07-21
Taxon:
Homo sapiens (human)
Gene:
ADAR (103)
Length:
6532
CDS:
988..3783

Additional Resources:

NCBI RefSeq record:
NM_001025107.3
NBCI Gene record:
ADAR (103)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001025107.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000336886 GACTGCGAAGGATAGTATATT pLKO_005 2901 CDS 100% 15.000 21.000 N ADAR n/a
2 TRCN0000336832 TTACCAAGGCCCGAGATATAA pLKO_005 1073 CDS 100% 15.000 21.000 N ADAR n/a
3 TRCN0000336885 TCACGAGCCCAAGTTCGTTTA pLKO_005 2361 CDS 100% 10.800 15.120 N ADAR n/a
4 TRCN0000050789 CGGATACTACACCCATCCATT pLKO.1 132 5UTR 100% 4.950 6.930 N ADAR n/a
5 TRCN0000050792 GCATGGGTTTCACAGAGGTAA pLKO.1 2504 CDS 100% 4.950 6.930 N ADAR n/a
6 TRCN0000050791 GCAGGGTATGTTGACTTTGAA pLKO.1 1432 CDS 100% 5.625 3.938 N ADAR n/a
7 TRCN0000050788 GCCCACTGTTATCTTCACTTT pLKO.1 6149 3UTR 100% 4.950 3.465 N ADAR n/a
8 TRCN0000301036 GCCCACTGTTATCTTCACTTT pLKO_005 6149 3UTR 100% 4.950 3.465 N ADAR n/a
9 TRCN0000050790 GCTGTTAGAATATGCCCAGTT pLKO.1 1623 CDS 100% 4.050 2.835 N ADAR n/a
10 TRCN0000301035 GCTGTTAGAATATGCCCAGTT pLKO_005 1623 CDS 100% 4.050 2.835 N ADAR n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001025107.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.