Transcript: Mouse NM_001025260.2

Mus musculus H2A histone family member L1E (H2al1e), mRNA.

Source:
NCBI, updated 2018-05-28
Taxon:
Mus musculus (mouse)
Gene:
H2al1e (547160)
Length:
494
CDS:
58..375

Additional Resources:

NCBI RefSeq record:
NM_001025260.2
NBCI Gene record:
H2al1e (547160)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001025260.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000281717 AGCTCCGCCAACTCTTCAAAC pLKO_005 320 CDS 100% 10.800 5.400 Y H2al1k n/a
2 TRCN0000281733 AGCTCTTCCGCACTTTCATTC pLKO_005 175 CDS 100% 10.800 5.400 Y H2al1k n/a
3 TRCN0000270446 CTTAGCCTTGTAGATCGTTTC pLKO_005 124 CDS 100% 6.000 3.000 Y H2al1k n/a
4 TRCN0000092894 CGAGTACTTAACATCGAACAT pLKO.1 210 CDS 100% 4.950 2.475 Y H2al1o n/a
5 TRCN0000193869 CGAGTACTTAACATCGAACAT pLKO.1 210 CDS 100% 4.950 2.475 Y H2al1m n/a
6 TRCN0000270447 CGCATAGCTCCAGAGGATGTA pLKO_005 274 CDS 100% 4.950 2.475 Y H2al1k n/a
7 TRCN0000173694 CTTCCTCTTAGCCTTGTAGAT pLKO.1 118 CDS 100% 4.950 2.475 Y H2al1m n/a
8 TRCN0000281716 GAGTACTTAACATCGAACATC pLKO_005 211 CDS 100% 4.950 2.475 Y H2al1k n/a
9 TRCN0000092829 GCAAAGGCGAAGAAGACAGAA pLKO.1 72 CDS 100% 4.950 2.475 Y LOC436255 n/a
10 TRCN0000092897 GCTTCCTCTTAGCCTTGTAGA pLKO.1 117 CDS 100% 4.950 2.475 Y H2al1o n/a
11 TRCN0000173900 GCTTCCTCTTAGCCTTGTAGA pLKO.1 117 CDS 100% 4.950 2.475 Y H2al1m n/a
12 TRCN0000270505 TCTTAGCCTTGTAGATCGTTT pLKO_005 123 CDS 100% 4.950 2.475 Y H2al1e n/a
13 TRCN0000272220 AGTACTTAACATCGAACATCC pLKO_005 212 CDS 100% 4.050 2.025 Y H2al1a n/a
14 TRCN0000270570 CTTTCATTCCTCACGAGTGTG pLKO_005 187 CDS 100% 4.050 2.025 Y H2al1e n/a
15 TRCN0000270508 GGTGGTACAGAACAACGAACA pLKO_005 300 CDS 100% 4.050 2.025 Y H2al1e n/a
16 TRCN0000272216 GTGGTACAGAACAACGAACAG pLKO_005 301 CDS 100% 4.050 2.025 Y H2al1a n/a
17 TRCN0000270569 TCGAGTACTTAACATCGAACA pLKO_005 209 CDS 100% 4.050 2.025 Y H2al1e n/a
18 TRCN0000092896 CTGGTGGTACAGAACAACGAA pLKO.1 298 CDS 100% 3.000 1.500 Y H2al1o n/a
19 TRCN0000271580 ACTTTCATTCCTCACGAGTGT pLKO_005 186 CDS 100% 2.640 1.320 Y H2al1a n/a
20 TRCN0000270504 TAGCTCCAGAGGATGTACGTC pLKO_005 278 CDS 100% 2.640 1.320 Y H2al1e n/a
21 TRCN0000194644 GATCGTTTCCTACGAGAGGAA pLKO.1 136 CDS 100% 0.264 0.132 Y H2al1m n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001025260.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.