Transcript: Human NM_001025591.3

Homo sapiens secretoglobin family 2B member 2 (SCGB2B2), mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
SCGB2B2 (284402)
Length:
3258
CDS:
23..313

Additional Resources:

NCBI RefSeq record:
NM_001025591.3
NBCI Gene record:
SCGB2B2 (284402)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001025591.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000162212 CTGGATATCGATAAACTGCTT pLKO.1 95 CDS 100% 2.640 3.696 N SCGB2B2 n/a
2 TRCN0000165261 GTCCAGCAATGCTTTGCCAAT pLKO.1 209 CDS 100% 4.050 3.240 N SCGB2B2 n/a
3 TRCN0000164077 CCTGGATATCGATAAACTGCT pLKO.1 94 CDS 100% 2.640 2.112 N SCGB2B2 n/a
4 TRCN0000165077 GTTTGATGTGTCCCAAGACCT pLKO.1 127 CDS 100% 2.640 2.112 N SCGB2B2 n/a
5 TRCN0000165536 GCCTGCCTGGATATCGATAAA pLKO.1 89 CDS 100% 13.200 9.240 N SCGB2B2 n/a
6 TRCN0000162614 CTTGCGAATGTTGTGTTTGAT pLKO.1 113 CDS 100% 5.625 3.938 N SCGB2B2 n/a
7 TRCN0000161493 GATAAACTGCTTGCGAATGTT pLKO.1 104 CDS 100% 5.625 3.938 N SCGB2B2 n/a
8 TRCN0000164516 CTCAATGTCCAGCAATGCTTT pLKO.1 203 CDS 100% 4.950 3.465 N SCGB2B2 n/a
9 TRCN0000163922 GCTTGCGAATGTTGTGTTTGA pLKO.1 112 CDS 100% 4.950 3.465 N SCGB2B2 n/a
10 TRCN0000164372 CTGCTTGCGAATGTTGTGTTT pLKO.1 110 CDS 100% 4.950 2.970 N SCGB2B2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001025591.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.