Transcript: Mouse NM_001029838.2

Mus musculus Pbx/knotted 1 homeobox 2 (Pknox2), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Pknox2 (208076)
Length:
3550
CDS:
280..1704

Additional Resources:

NCBI RefSeq record:
NM_001029838.2
NBCI Gene record:
Pknox2 (208076)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001029838.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421448 ATGAGCTACAGACAACGAATG pLKO_005 1643 CDS 100% 6.000 8.400 N Pknox2 n/a
2 TRCN0000018223 CCACCAATATAATGCGTTCTT pLKO.1 1175 CDS 100% 4.950 6.930 N PKNOX2 n/a
3 TRCN0000070812 CCGTCAATTCTCAAGTCGTGT pLKO.1 974 CDS 100% 2.640 3.696 N Pknox2 n/a
4 TRCN0000417413 CAATGATGGCCACGCAGAATG pLKO_005 314 CDS 100% 10.800 8.640 N Pknox2 n/a
5 TRCN0000070811 CCCAAAGATTCTGGCCCAATT pLKO.1 1394 CDS 100% 10.800 8.640 N Pknox2 n/a
6 TRCN0000424065 GAGATCTGGACTCACCGAATA pLKO_005 1967 3UTR 100% 10.800 8.640 N Pknox2 n/a
7 TRCN0000070808 GCACATGATGATTCATTGGAT pLKO.1 1549 CDS 100% 3.000 2.400 N Pknox2 n/a
8 TRCN0000433068 CCAAGCATGCCACCAATATAA pLKO_005 1166 CDS 100% 15.000 10.500 N Pknox2 n/a
9 TRCN0000430438 TAGAGTTGGAGAAAGTCAATG pLKO_005 716 CDS 100% 10.800 7.560 N Pknox2 n/a
10 TRCN0000018224 CCTGGACAATGAGGATAAGAA pLKO.1 1119 CDS 100% 5.625 3.938 N PKNOX2 n/a
11 TRCN0000018225 CTGACGCTGCTGTTTGAGAAA pLKO.1 526 CDS 100% 4.950 3.465 N PKNOX2 n/a
12 TRCN0000018226 GATGACCCAGAACTGGACAAT pLKO.1 655 CDS 100% 4.950 3.465 N PKNOX2 n/a
13 TRCN0000070810 GCAGGAACACAAACCCTTCTT pLKO.1 630 CDS 100% 4.950 3.465 N Pknox2 n/a
14 TRCN0000070809 CCTCACCCTTCTGCAAGTAAA pLKO.1 1266 CDS 100% 13.200 7.920 N Pknox2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001029838.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.