Transcript: Human NM_001029852.3

Homo sapiens phosphodiesterase 8B (PDE8B), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
PDE8B (8622)
Length:
5992
CDS:
247..2739

Additional Resources:

NCBI RefSeq record:
NM_001029852.3
NBCI Gene record:
PDE8B (8622)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001029852.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430396 TTGGAAGCCATTACGCATAAA pLKO_005 1771 CDS 100% 13.200 18.480 N PDE8B n/a
2 TRCN0000048735 GCGCCAGGCTATTATTGACAT pLKO.1 2229 CDS 100% 4.950 6.930 N PDE8B n/a
3 TRCN0000432287 CCATTGACGTGAAATCGATAT pLKO_005 1496 CDS 100% 10.800 8.640 N PDE8B n/a
4 TRCN0000048733 GCAGCATAATTGCTTGCTATA pLKO.1 971 CDS 100% 10.800 8.640 N PDE8B n/a
5 TRCN0000433209 ATATTGACAGGAACCATTATC pLKO_005 2201 CDS 100% 13.200 9.240 N PDE8B n/a
6 TRCN0000427682 ATCGATCTGAAGGATTCATAA pLKO_005 3176 3UTR 100% 13.200 9.240 N PDE8B n/a
7 TRCN0000048734 CGCTCAAGAAACTGTGTTGTA pLKO.1 1373 CDS 100% 4.950 3.465 N PDE8B n/a
8 TRCN0000048737 GCCTCATTCATTCAGATATAA pLKO.1 1458 CDS 100% 15.000 9.000 N PDE8B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001029852.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.