Transcript: Mouse NM_001029890.3

Mus musculus mex3 RNA binding family member A (Mex3a), mRNA.

Source:
NCBI, updated 2019-06-19
Taxon:
Mus musculus (mouse)
Gene:
Mex3a (72640)
Length:
6225
CDS:
450..2012

Additional Resources:

NCBI RefSeq record:
NM_001029890.3
NBCI Gene record:
Mex3a (72640)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001029890.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000255047 ACACAAGCCATCCGAATATTT pLKO_005 1986 CDS 100% 15.000 21.000 N Mex3a n/a
2 TRCN0000216164 CGATACTCAAGATAGCTTAAA pLKO.1 4745 3UTR 100% 13.200 18.480 N Mex3a n/a
3 TRCN0000255048 GACTTTGGCTACAGCGGATAT pLKO_005 1533 CDS 100% 10.800 15.120 N Mex3a n/a
4 TRCN0000255046 GCAAGCAGGACGTGTACTATG pLKO_005 1576 CDS 100% 10.800 15.120 N Mex3a n/a
5 TRCN0000216746 GCACCTAGCTGAACCATTATT pLKO.1 3156 3UTR 100% 15.000 10.500 N Mex3a n/a
6 TRCN0000255045 GCACCTAGCTGAACCATTATT pLKO_005 3156 3UTR 100% 15.000 10.500 N Mex3a n/a
7 TRCN0000230492 AGGCAAGGCTGCAAGATTAAG pLKO_005 897 CDS 100% 13.200 9.240 N MEX3A n/a
8 TRCN0000255049 TGAGCACTTCTCCATGATAAG pLKO_005 1040 CDS 100% 10.800 7.560 N Mex3a n/a
9 TRCN0000191842 GCAAGATTCTTGAATACAACA pLKO.1 1327 CDS 100% 4.950 3.465 N Mex3a n/a
10 TRCN0000202270 GCAGACCAACACGTACATCAT pLKO.1 1202 CDS 100% 4.950 3.465 N Mex3a n/a
11 TRCN0000189685 GCTGAGCACTTCTCCATGATA pLKO.1 1038 CDS 100% 5.625 3.375 N Mex3a n/a
12 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2463 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001029890.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.