Transcript: Mouse NM_001029895.3

Mus musculus arginyltransferase 1 (Ate1), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Ate1 (11907)
Length:
5020
CDS:
409..1938

Additional Resources:

NCBI RefSeq record:
NM_001029895.3
NBCI Gene record:
Ate1 (11907)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001029895.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000366532 ATGAGAATCTTGTGGTTAATA pLKO_005 2067 3UTR 100% 15.000 21.000 N Ate1 n/a
2 TRCN0000366600 TGCCATGCCTTACGGTGTTTA pLKO_005 1815 CDS 100% 13.200 18.480 N Ate1 n/a
3 TRCN0000375423 TCTACTACGATCCTGATTATT pLKO_005 1484 CDS 100% 15.000 12.000 N Ate1 n/a
4 TRCN0000375424 GATGAGATACAAGGGTCAATA pLKO_005 1626 CDS 100% 13.200 10.560 N Ate1 n/a
5 TRCN0000366533 CATCGCAACTCAGCTATTATT pLKO_005 1574 CDS 100% 15.000 10.500 N Ate1 n/a
6 TRCN0000124628 GAGTCTTACCAGGTCTATAAA pLKO.1 1249 CDS 100% 15.000 10.500 N Ate1 n/a
7 TRCN0000366599 AGGATTATCAGGATCTTATAG pLKO_005 521 CDS 100% 13.200 9.240 N Ate1 n/a
8 TRCN0000124625 GCCATGCCTTACGGTGTTTAT pLKO.1 1816 CDS 100% 13.200 9.240 N Ate1 n/a
9 TRCN0000366598 GGAGTCTTACCAGGTCTATAA pLKO_005 1248 CDS 100% 13.200 9.240 N Ate1 n/a
10 TRCN0000375425 GGCTCGATGGGAAGATCATTG pLKO_005 1415 CDS 100% 10.800 7.560 N Ate1 n/a
11 TRCN0000124624 CGGCTGATTCTGTCAGTGATT pLKO.1 4286 3UTR 100% 4.950 3.465 N Ate1 n/a
12 TRCN0000124626 GCCAGTTTACAAGATTCCTTT pLKO.1 1319 CDS 100% 4.950 3.465 N Ate1 n/a
13 TRCN0000124627 GCATTAATTAACAAGCTGGAT pLKO.1 772 CDS 100% 2.640 1.848 N Ate1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001029895.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.