Transcript: Mouse NM_001030292.1

Mus musculus potassium channel, subfamily K, member 15 (Kcnk15), mRNA.

Source:
NCBI, updated 2015-09-23
Taxon:
Mus musculus (mouse)
Gene:
Kcnk15 (241769)
Length:
1032
CDS:
1..1032

Additional Resources:

NCBI RefSeq record:
NM_001030292.1
NBCI Gene record:
Kcnk15 (241769)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001030292.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000069605 GCACGTCTCTGCTGAGAACAT pLKO.1 513 CDS 100% 4.950 3.465 N Kcnk15 n/a
2 TRCN0000069604 CATTCTGTGCATCCTGTCCTA pLKO.1 90 CDS 100% 2.640 1.848 N Kcnk15 n/a
3 TRCN0000069607 CGAGCGTCTAAACACACTGGT pLKO.1 444 CDS 100% 2.640 1.848 N Kcnk15 n/a
4 TRCN0000069606 GTTCCGCAGAAAGTACCGCTT pLKO.1 198 CDS 100% 2.160 1.512 N Kcnk15 n/a
5 TRCN0000069603 CGCCTACTACTACTGCTTCAT pLKO.1 621 CDS 100% 4.950 2.970 N Kcnk15 n/a
6 TRCN0000043729 CCACGCCTACTACTACTGCTT pLKO.1 618 CDS 100% 2.640 1.584 N KCNK15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001030292.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.