Transcript: Mouse NM_001030293.2

Mus musculus sprouty homolog 3 (Drosophila) (Spry3), mRNA.

Source:
NCBI, updated 2017-04-29
Taxon:
Mus musculus (mouse)
Gene:
Spry3 (236576)
Length:
4542
CDS:
438..1304

Additional Resources:

NCBI RefSeq record:
NM_001030293.2
NBCI Gene record:
Spry3 (236576)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001030293.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000065540 GTCTAGTATTTCCAGCTCAAT pLKO.1 680 CDS 100% 4.950 3.465 N Spry3 n/a
2 TRCN0000065542 CCATGAGTCTCATCTCCCTTT pLKO.1 1108 CDS 100% 4.050 2.835 N Spry3 n/a
3 TRCN0000065541 CTGAGCAATCTGTAGGGCATT pLKO.1 835 CDS 100% 4.050 2.835 N Spry3 n/a
4 TRCN0000065539 GCACCCTGTAAACAAGCTCTT pLKO.1 534 CDS 100% 4.050 2.835 N Spry3 n/a
5 TRCN0000065538 GCCTCCTTGATTATGGCACTT pLKO.1 976 CDS 100% 4.050 2.835 N Spry3 n/a
6 TRCN0000056811 CCACTGATGATGAAGACAACT pLKO.1 1033 CDS 100% 4.950 2.970 N SPRY3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001030293.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.