Transcript: Mouse NM_001033042.3

Mus musculus leucine rich repeat containing 14B (Lrrc14b), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Lrrc14b (432779)
Length:
2746
CDS:
42..1574

Additional Resources:

NCBI RefSeq record:
NM_001033042.3
NBCI Gene record:
Lrrc14b (432779)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001033042.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000254150 CTAGCCAACTGTGCCCTTAAT pLKO_005 960 CDS 100% 13.200 18.480 N Lrrc14b n/a
2 TRCN0000192275 CAGGAGAACCTGGACAATATA pLKO.1 99 CDS 100% 15.000 10.500 N Lrrc14b n/a
3 TRCN0000254149 CAGGAGAACCTGGACAATATA pLKO_005 99 CDS 100% 15.000 10.500 N Lrrc14b n/a
4 TRCN0000254153 CTCCCTAGGCTTCGCCATATT pLKO_005 1272 CDS 100% 13.200 9.240 N Lrrc14b n/a
5 TRCN0000215454 GATCTTCTCCTTACCTCTATT pLKO.1 822 CDS 100% 13.200 9.240 N Lrrc14b n/a
6 TRCN0000254151 GTTAGCACAGCAAGATCTTAA pLKO_005 1771 3UTR 100% 13.200 9.240 N Lrrc14b n/a
7 TRCN0000200952 CCACAAGATTTCCTCAGAGAA pLKO.1 1677 3UTR 100% 4.950 3.465 N Lrrc14b n/a
8 TRCN0000254152 ATCTTCTCCTTACCTCTATTG pLKO_005 823 CDS 100% 10.800 6.480 N Lrrc14b n/a
9 TRCN0000106535 GCCTGGTCTACAAAGTGAGTT pLKO.1 2048 3UTR 100% 4.950 2.475 Y Gad2 n/a
10 TRCN0000054408 ACGCCTTTAATCCCAGCACTT pLKO.1 1989 3UTR 100% 4.050 2.025 Y Mtif2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001033042.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.