Transcript: Mouse NM_001033123.3

Mus musculus predicted gene 14288 (Gm14288), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Gm14288 (13999)
Length:
428
CDS:
78..272

Additional Resources:

NCBI RefSeq record:
NM_001033123.3
NBCI Gene record:
Gm14288 (13999)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001033123.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000239456 AGAAGTCATGGAAGGTAATTT pLKO_005 255 CDS 100% 15.000 7.500 Y Gm14288 n/a
2 TRCN0000242348 ACATACAATTGAAGACCATTT pLKO_005 224 CDS 100% 10.800 5.400 Y Gm14393 n/a
3 TRCN0000243733 ATAGGAATCTCACAGCTATAG pLKO_005 187 CDS 100% 10.800 5.400 Y Gm14322 n/a
4 TRCN0000239453 CATACAATTGAAGACCATTTC pLKO_005 225 CDS 100% 10.800 5.400 Y Gm14288 n/a
5 TRCN0000239455 CTCAGAAGAGTCTCTACAAAG pLKO_005 148 CDS 100% 10.800 5.400 Y Gm14288 n/a
6 TRCN0000239454 TGTGATGGTAGAGACCTATAG pLKO_005 170 CDS 100% 10.800 5.400 Y Gm14288 n/a
7 TRCN0000243741 ACTCAGGAAGAGTGGGCTTTG pLKO_005 117 CDS 100% 6.000 3.000 Y Gm14411 n/a
8 TRCN0000242406 GAGTCTCTACAAAGGTGTGAT pLKO_005 155 CDS 100% 4.950 2.475 Y Gm14418 n/a
9 TRCN0000243742 CACCTATGATGACGTGCATGT pLKO_005 89 CDS 100% 4.050 2.025 Y Gm14411 n/a
10 TRCN0000095226 CATGTGAACTTCACTCAGGAA pLKO.1 105 CDS 100% 2.640 1.320 Y Zfp950 n/a
11 TRCN0000239452 GTCTATGTCAAATACGTAATT pLKO_005 410 3UTR 100% 13.200 6.600 Y Gm14288 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001033123.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.