Transcript: Mouse NM_001033213.1

Mus musculus tetratricopeptide repeat domain 7B (Ttc7b), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Ttc7b (104718)
Length:
3458
CDS:
132..2663

Additional Resources:

NCBI RefSeq record:
NM_001033213.1
NBCI Gene record:
Ttc7b (104718)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001033213.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000341694 AGGGTAATGCTAACTAATATT pLKO_005 705 CDS 100% 15.000 10.500 N Ttc7b n/a
2 TRCN0000341695 TTACGTGGAAGGAGATTATAA pLKO_005 452 CDS 100% 15.000 10.500 N Ttc7b n/a
3 TRCN0000341764 ATGTAACCAGAGTGGATTAAC pLKO_005 2772 3UTR 100% 13.200 9.240 N Ttc7b n/a
4 TRCN0000341693 GTTTCGTCCTCTACCAGTAAT pLKO_005 600 CDS 100% 13.200 9.240 N Ttc7b n/a
5 TRCN0000341767 TCTTCCCAATGTCCCATAATG pLKO_005 2305 CDS 100% 13.200 9.240 N Ttc7b n/a
6 TRCN0000146681 CCTACAAGAATCCAATCTGAT pLKO.1 416 CDS 100% 4.950 3.465 N TTC7B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001033213.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.