Transcript: Mouse NM_001033258.4

Mus musculus ARFGEF family member 3 (Arfgef3), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Arfgef3 (215821)
Length:
8216
CDS:
134..6646

Additional Resources:

NCBI RefSeq record:
NM_001033258.4
NBCI Gene record:
Arfgef3 (215821)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001033258.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000267453 TGTTGCATTTGCCCGTTATAT pLKO_005 2692 CDS 100% 15.000 21.000 N Arfgef3 n/a
2 TRCN0000252872 CGGTAAGTCAAGCTGATATAA pLKO_005 7022 3UTR 100% 15.000 10.500 N Arfgef3 n/a
3 TRCN0000252873 ATGCCCTTAAAGCCAATATTC pLKO_005 4340 CDS 100% 13.200 9.240 N Arfgef3 n/a
4 TRCN0000252871 GACAGGAGAATACGATAATTG pLKO_005 663 CDS 100% 13.200 9.240 N Arfgef3 n/a
5 TRCN0000252870 TTGATTCCTGTGATCAGTATT pLKO_005 1944 CDS 100% 13.200 9.240 N Arfgef3 n/a
6 TRCN0000140988 CTCTACTTTCTGCTCAGGCAT pLKO.1 2233 CDS 100% 2.640 1.848 N ARFGEF3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001033258.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.