Transcript: Mouse NM_001033286.2

Mus musculus solute carrier family 30, member 10 (Slc30a10), mRNA.

Source:
NCBI, updated 2019-05-21
Taxon:
Mus musculus (mouse)
Gene:
Slc30a10 (226781)
Length:
5836
CDS:
217..1629

Additional Resources:

NCBI RefSeq record:
NM_001033286.2
NBCI Gene record:
Slc30a10 (226781)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001033286.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000252050 AGGTGAACGTCAGCTTATTTA pLKO_005 2130 3UTR 100% 15.000 10.500 N Slc30a10 n/a
2 TRCN0000252051 CTGTTGTCATGGTCATCATTA pLKO_005 1043 CDS 100% 13.200 9.240 N Slc30a10 n/a
3 TRCN0000252048 GAAGTCTGAAGCACTCAATAT pLKO_005 885 CDS 100% 13.200 9.240 N Slc30a10 n/a
4 TRCN0000252049 TGGTCATCACGGCTATCATAT pLKO_005 956 CDS 100% 13.200 9.240 N Slc30a10 n/a
5 TRCN0000166364 CACACACACACACACACACAA pLKO.1 4492 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001033286.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.