Transcript: Mouse NM_001033294.3

Mus musculus DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 31 (Ddx31), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Ddx31 (227674)
Length:
3328
CDS:
447..2510

Additional Resources:

NCBI RefSeq record:
NM_001033294.3
NBCI Gene record:
Ddx31 (227674)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001033294.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000182985 CAAGACTTCATCGCTGTTTAA pLKO.1 662 CDS 100% 13.200 18.480 N Ddx31 n/a
2 TRCN0000184150 CGACACTCACAGAAGGTGTAA pLKO.1 1333 CDS 100% 4.950 6.930 N Ddx31 n/a
3 TRCN0000217063 CGGCTAGTTGATATCAGTTTG pLKO.1 1356 CDS 100% 10.800 7.560 N Ddx31 n/a
4 TRCN0000217792 CTAAGAGATGCTCCTAGAAAC pLKO.1 2283 CDS 100% 10.800 7.560 N Ddx31 n/a
5 TRCN0000196044 GCTGTGAAGAAGGCAAGCTTA pLKO.1 2316 CDS 100% 4.950 3.465 N Ddx31 n/a
6 TRCN0000179461 GCTTCTTGTGAGATTGCTCAT pLKO.1 2789 3UTR 100% 4.050 2.835 N Ddx31 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001033294.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.